Tổng hoà những quan hệ kinh tế trong đó nhu cầu của các chủ thể được đáp ứng thông qua việc trao đổi, mua bán với sự xác định giá cả, số lượng hàng hoá, dịch vụ tương ứng với trình độ phát triển nhất định của nền sản xuất là
Hãy suy nghĩ và trả lời câu hỏi trước khi xem đáp án
Câu hỏi liên quan
Tại sao việc đọc tài liệu hướng dẫn sử dụng thiết bị số lại quan trọng?
Ngày luôn luôn dài bằng đêm tại
Khi xem xét kiến trúc và triển khai của Internet vạn vật, phương án nào sau đây được coi là yếu tố quyết định ảnh hưởng đến khả năng tích hợp và mở rộng của các thiết bị IoT trong một hệ thống phức tạp?
Cuộc cách mạng nào dưới đây trở thành cốt lõi của cuộc cách mạng khoa học- công nghệ diễn ra từ những năm 70 của thế kỉ XX?
Nguyên tố Q có số hiệu nguyên tử bằng 14. Electron cuối cùng của nguyên tử nguyên tố Q điền vào lớp, phân lớp nào sau đây?
Câu 2: Cho bảng số liệu:
LƯU LƯỢNG NƯỚC TRUNG BÌNH THÁNG CỦA SÔNG HỒNG TẠI TRẠM HÀ NỘI (Đơn vị: m³/s)
Tháng
1
2
3
4
5
6
7
8
9
10
11
12
Lưu lượng
1455
1343
1215
1522
2403
4214
7300
7266
5181
3507
2240
1517
(Nguồn: Tổng cục thống kê)
Căn cứ vào bảng số liệu, tính lưu lượng nước trung bình tháng của sông Hồng (làm tròn kết quả đến chữ số thập phân thứ nhất của m3/s).
Phần bù của \([ - 1;5)\) trong \(\mathbb{R}\) là?
Đâu là những động vật sinh trưởng và phát triển qua biến thái hoàn toàn?
Phát biểu nào sau đây đúng?
Read the following advertisement and mark the letter A, B, C or D on your answer sheet to indicate the option that best fits each of the numbered blanks from 1 to 6.
Living Every Moment Fully: Secrets to Happiness in the Digital Era
Are you seeking balance in your life? The (1)_________ balance between online and offline worlds awaits you!
Our modern (2)_________ create unnecessary daily life stress in our increasingly connected world. Stolen moments (3)_________ your phone during important conversations add up to lost time. We should remind people (4)_________ the value of being present together.
The secret (5)_________ in finding your perfect digital-life harmony through mindful technology use. Start prioritizing real connections today (6)_________ your life into something meaningful.
Contact us now at Digital Wellness Center for your free consultation!
Kết quả chung của các cuộc cách mạng tư sản thế kỉ XVI – XVIII là
Phần II. Câu trắc nghiệm đúng sai. Thí sinh trả lời từ câu 1 đến câu 4. Trong mỗi ý a), b), c), d) ở mỗi câu, thí sinh chọn đúng hoặc sai.
Cho biết các codon mã hoá các amino acid trong bảng sau đây:
Amino acid
Leu
Trp
His
Arg
Codon
5’CUU3’; 5’CUC3’; 5’CUA3’; 5’CUG3’
5’UGG3’
5’CAU3’; 5’CAC3’
5’CGU3’; 5’CGC3’; 5’CGA3’; 5’CGG3’
Triplet mã hoá là các bộ ba ứng với các codon mã hoá amino acid và triplet kết thúc ứng với codon kết thúc trên mRNA. Giả sử một đoạn gene ở vi khuẩn tổng hợp đoạn mRNA có triplet mở đầu và trình tự các nucleotide như sau:
Mạch làm khuôn tổng hợp mRNA
3’TACGAAACCGCCGTAGCAATT5’
mRNA
5’AUGCUUUGGCGGCAUCGUUAA3’
Biết rằng, mỗi đột biến điểm dạng thay thế một cặp nucleotide trên đoạn gene này tạo ra một allele mới.
Một vật được làm lạnh sao cho thể tích của vật không thay đổi thì nội năng của vật
Cho các polymer sau: nylon-6,6, cellulose triacetate, poly(methyl methacrylate), poly(vinyl chloride), polystyrene. Có bao nhiêu polymer bị phân huỷ trong môi trường kiềm?
The art form of the opera (18) ______ during the 1590s. At the time a group of composers and artists known as the Camerata were interested in injecting storytelling into music. They were inspired by the belief that the great tragic plays of ancient Greece had been sung rather than simply acted. Another motivation may have been the desire of the composers to find an alternative to the production of music for the Church, (19) ______. This is supported by the selection of material for the opera. Early composers took their material from the mythologies of ancient Rome and Greece, which was full of plot twists, betrayals, and love affairs. From the very beginning, the sobriety of the Church had little place in opera.
(20) ______. Composers quickly embraced the new art form for the opportunities and creative freedom it offered. Wealthy nobles supported the opera because its elaborate and expensive performances allowed them to display their wealth as well as their sophistication. The early years of opera were marked primarily by experimentation. (21) ______, everything was new and untested. Early composers experimented with the structure, subject material, and organization of the opera. They tried different placements for the orchestra, as well as different sizes. By the early 1600s, however, (22) ______.
Read the following passage about opera and mark the letter A, B, C, or D on your answer sheet to indicate the option that best fits each of the numbered blanks from 18 to 22.
Tập hợp các quy phạm pháp luật có đặc tính chung để điều chỉnh các quan hệ xã hội trong một lĩnh vực nhất định của đời sống xã hội gọi là gì?
Cho đoạn chương trình sau:
Trong đoạn chương trình trên s được gọi là?
Ở khu vực Mỹ Latinh có thuận lợi nào để phát triển cây lương thực và thực phẩm?
Read the following passage about Vietnamese cultural identity and mark the letter A, B, C, or D on your answer sheet to indicate the best answer to each of the following questions from 23 to 30.
Vietnamese cultural identity is a rich and intricate tapestry that reflects the nation’s long and storied history. Rooted in over a thousand years of civilization, Vietnam’s cultural identity is a fusion of indigenous traditions and external influences, shaped by its geographical location and historical interactions.
First and foremost, at the heart of Vietnamese culture is a deep reverence for family and community. Confucian values emphasizing respect for elders, filial piety, and social harmony have played a pivotal role in shaping Vietnamese society. These values are reflected in the close-knit family structures, hierarchical relationships, and communal rituals that are integral to daily life.
Secondly, Vietnamese cuisine is celebrated worldwide for its exquisite flavors and diversity. With its emphasis on fresh ingredients, fragrant herbs, and balanced flavors, Vietnamese food tells a story of the country’s agricultural heritage and regional variations. Iconic dishes like pho, banh mi, and spring rolls have become global favorites, representing the culinary artistry deeply ingrained in Vietnamese culture. Also, Vietnam’s artistic expressions are equally captivating. Traditional art forms like water puppetry, silk painting, and folk music continue to thrive alongside contemporary artistic movements. Ao dai, a graceful traditional dress, exemplifies the fusion of elegance and modesty in Vietnamese fashion, symbolizing cultural pride and identity.
Today, in the face of modernization and globalization, Vietnamese cultural identity remains resilient. While adapting to the challenges of the 21st century, the Vietnamese people continue to honor their traditions, celebrate their unique cultural expressions, and pass on their heritage to future generations, ensuring that their cultural identity remains vibrant and enduring.
(Adapted from Saigoneer)
The word ‘their’ in paragraph 4 refers to ______.
Ánh sáng tác động đến cây trồng thông qua mấy yếu tố?